Synthego FAQs | Comparably
Precision and automation for genome engineering - enabling rapid, cost-effective research with consistent results for every scientist. read more
EMPLOYEE
PARTICIPANTS
19
TOTAL
RATINGS
274

Synthego FAQs

Synthego's Frequently Asked Questions page is a central hub where its customers can always go to with their most common questions. These are the 111 most popular questions Synthego receives.

Frequently Asked Questions About Synthego

  • Yes, we guarantee that the KO cell pool shipped to you will have at least 50% protein knockout. Synthego sgRNAs typically have a median editing efficiency of ~80%, and can achieve editing rates of up to 97%. As part of your knockout cell pool order, you will receive an indel efficiency report generated by Synthegos Inference of CRISPR Edits (ICE) tool.

    See conditions of the guarantee here

    View Article
  • What does it mean when ICE reports "guide not found in sequence"The guide RNA sequence which you provide to the tool must be present in the control sanger sequence file. If the tool is unable to loacte the provided guide sequence in the control file, then it is unable to predict the cutsite and associated indel patterns.

    What is causing the error?There are several reasons why the tool may recognize this error:1) The incorrect guide sequence may have been input into the tool2) The incorrect region of the genome may have been amplified and/or sequenced3) The quality of the .ab1 file may be too low for the tool to recognize the guide sequence or the region around it.

    What can I do to fix these issues?1) Verify that you have entered the correct 17-23 nucleotide guide sequence, excluding the PAM site.2) Verify that the guide sequence you entered is present in the control .ab1 file. This can be done by simply opening the .ab1 file and using the "command+F" function to search for the entered guide sequence.3) Check that the quality of the .ab1 file is sufficient. (See the "What can I do to fix these issues" section in the "Quality Score too low" Help Article)

    If the problem persists, please contact [email protected] with the following information:- Url link to the analysis results if available- Control and edited sample files with a description of which control file corresponds to which edited file- Guide sequence(s) and which control/edited file pair it corresponds to- screenshots of any error messages or relevant details.

    View Article
  • Please consult the Synthego Quick Start Guide on the Resources page for best practices related to dissolving, annealing and storing synthetic guide RNAs.

    View Article
  • The unexplained fraction is not summed to the wild-type fraction. The unexplained fraction is defined as 1-r2. So, if your r2 is 0.8, you could have 20% unexplained, 60% wild-type, and 20% edited.

    View Article
  • Inference of CRISPR Editing (ICE) is an open-source, free to use,web-based tool ( https://ice.synthego.com ) that quickly determines rates of CRISPR-Cas9 editing at a specific, sgRNA directed genomic location within a cell population. Following delivery of CRISPR components, genomic DNA from both edited and unedited (control) populations is PCR-amplified and Sanger sequenced. ICE compares these sequence traces to give a detailed analysis of CRISPR editing.

    The current version of ICE software can analyze indels that result from single or multiplex CRISPR-Cas9 double-strand DNA breaks using SpCas9. More features will be added to the ICE software tool soon. To request other nucleases or other features and functionalities, please email [email protected].

    View Article
  • PCR amplicons of an sgRNA targeted genomic region should be generated in a similar way to those used for TIDE analysis. In general, a 400-800 bp PCR amplicon length is best amenable to ICE analysis. For best results, the use of PCR primers that are 1822 bp in length, with Tm >55C and 4560% GC content should be used. It is best to design the forward and reverse primers at least 150 bp from the closest sgRNA cut-site to allow for optimal sequencing across the edit. There are a number of free online tools which can help you with designing primers such as Primer 3. Tools such as Primer Blast can also be used to check for off-target amplification.

    The genomic PCR conditions including primers, annealing temperature, and amount of genomic DNA need to be optimized until a single band of the correct size is obtained. After DNA extraction from a cell population, PCR amplicons should be verified by gel electrophoresis and purified prior to Sanger sequencing.

    View Article
  • When ordering, enter the 17-20nt protospacer domain (your target sequence) directly into the order page as an RNA oligo sequence. Enter the sequence in a forward orientation so that the PAM site is downstream of your sequence, and do not include the PAM site. The ordering system will automatically add a 22-mer linker to your sequence, allowing you to anneal to our standard tracrRNA to form a functional guide RNA.

    For example:

    View Article
  • Knock-in analysis

    Analyze HDR-mediated edits from donors up to 300 bp in length

    You can now analyze knock-in edits in addition to knock-outs. Simply specify your donor sequence (up to 300 bp) in addition to your guide sequence and Sanger sequence data and ICE will calculate the efficiency of your edit. Single-base substitutions and small and medium-sized insertions can all be accommodated.

    Improved modeling of genotype contributions

    Results in fewer spurious genotype calls of low-abundance contributions

    We have improved our modeling approach to disfavor genotype contributions that are unlikely to be truly present in analyzed samples. The impact is higher confidence in the remaining contributions and more accurate results overall. Youll notice fewer contributions overall in the contributions tab, especially those of low abundance (typically under 1-2%). This improvement may result in slightly lower estimates of indel percentage and knockout-score for some analyses.

    Enhanced multi-guide analysis support

    Supports larger variety of multi-guide edits

    Improvements to our modeling of multi-guide events provide more accurate representation of particularly large deletions. Analyses of large edits that previously would have failed will now succeed.

    Minor updates

    Clarified table headers

    Appropriate precision in abundance estimates

    More informative error messages

    Bug fixes

    View Article
  • Currently, ICE is smart enough to choose an appropriate Indel analysis window in order to generate correct alignments and inferences. In the case that this cannot be determined, an Orange check mark will appear next to a specific analysis, which will provide some details on how analysis of this sample differed. Future versions may enable user-defined custom parameters for analysis.

    View Article
  • Section 1: Introduction

    Section 2: Sample-By Sample Analysis

    Section 3: Batch Analysis

    ________________________________________________________________________________

    Section 1: Introduction

    Inference of CRISPR Editing (ICE) is a free online tool that provides an easy quantitative assessment of genome editing. The software compares the sequence traces of amplicons generated from genomic DNA isolated from both the edited and unedited (control) pools of cells to identify percentage of genomes modified with insertions and deletions (indels). Ideally, the desired indel should be located ~200 bp downstream of the sequencing primer. For a more complete guide to ICE analysis including detailed explanation and examples, reference Hsiau, et al. biorxiv (2018).

    The current version of ICE software can analyze indels that result from single or multiplex CRISPR-Cas9 double-strand DNA breaks using SpCas9. More features will be added to the ICE software tool soon. To request other nucleases or other features and functionalities, please email [email protected] welcome your feedback.

    Learning how to use the ICE software tool is quick and easy. Simply upload your Sanger sequencing files and provide basic information such as your sample names and guide sequences, and ICE will do the rest. There are no parameters that need optimizing and no complicated steps to learn. For increased flexibility and scalability, the ICE software has two analysis formats: sample by sample analysis, which can compare up to five editing experiments at a time, and batch analysis, which compares hundreds of samples simultaneously.

    Below are step-by-step instructions on how to conduct both types of analyses.

    Section 2: Sample-By-Sample Analysis

    To run a Sample-By-Sample ICE analysis follow these steps:

    Go to https://ice.synthego.com

    Click on the Sample by Sample Upload tab.

    Add .ab1 files by dropping into the upload space, or by clicking browse your files to open all files. If the upload file type is correct, it will turn green; if not, it will turn red.

    Add the following Information:

    Control .ab1 File (left): upload control Sanger sequence files ( .ab1 format)

    Edit .ab1 File (right): upload experimental Sanger sequence files ( .ab1 format)

    Guide Target Sequence: add the 17-23 nucleotide sequence of the DNA-targeting region of the guide RNA excluding the PAM. This can be provided as either DNA or RNA sequence.

    Label: a unique sample name will be automatically generated with your Edit File name. The names can be modified to any unique sample name (255 character limit).

    Example:

    Download the example files (on lower left) and upload/enter the following information into Sample-By-Sample form:

    Control .ab1 File (left): CEL_Negative;CEL_R2.ab1

    Edit .ab1 File (right): CEL_modcrispr_1_A;CEL_R2.ab1

    Guide Target Sequence: AACCAGTTGCAGGCGCCCCA

    Click Add to Analysis. The files will display in the table called Your Experiment, which is a running summary of all your uploads:

    https://ice.synthego.com

    Additional files can be added one at a time for up to 700 individual analyses. To add additional samples for analysis, fill in the form again with the information for each sample as noted above. Each new sample will be added as a new row (Test 1, Test 2, etc.) in the table:

    Note: If over five editing outcomes are being analyzed at any given time, we recommend using the use of Batch Analysis.

    To complete the analysis and look over the outcomes of the ICE analysis, Click Analyze Experiment. For an explanation of analysis results, please see the section entitled Overview of Editing Analysis by ICE below.

    Section 3: Batch Analysis

    To run a Batch ICE analysis follow these steps:

    Go to

    Click on the Batch Upload tab.

    Add Zip and Excel files by dropping into the upload space, or by clicking browse your files to open all files. If the upload file type is correct, it will turn green; if not, it will turn red.

    Add the following information:

    .ab1 Files (left): ZIP archive containing .ab1 files

    Add a single .zip file containing experimental and negative controls (wild-type) Sanger sequence files (.ab1 format). More than one control sequence can be used. Up to 700 samples can be included in the .zip file and analyzed at once (file size limit is 225 MB).

    Definition File (right): Excel file with definitions of .ab1 files

    A single Microsoft Excel file (.xlsx format only) that lists a unique label, the control file name, the experimental file name, and the guide sequence for each sample. Example and template files (template_definitions.xlsx) can be downloaded on the ICE webpage. See example below:

    Note: Please follow these instructions for the Excel file upload:

    Do not modify or change the current headers in the template_definitions.xlsx.

    The Label column is used for labelling your samples with a unique name that has a 255 character limit.

    The Control Files column should contain the name of the .ab1 file containing the Sanger sequence for each negative control (e.g. CEL_Negative;CEL_R2.ab1). This file must be included in the zip file.

    The Experiment Files column should contain the name of the .ab1 file containing the Sanger sequence for each experimental sample (e.g. CEL_modcrispr_1_A;CEL_R2.ab1). This file must be included in the zip file.

    The Guide Sequence column should contain the 17-23 nucleotide sequence of the DNA-targeting region of the guide RNA (excluding the PAM) for each sample. This can be provided as either DNA or RNA sequence (e.g. AACCAGTTGCAGGCGCCCCA or AACCAGUUGCAGGCGCCCCA). By default, ICE assumes you are using spCas9. However, ICE does not check if the PAM site is NGG and uses the input guide sequence to place the predicted cutsite 3bp upstream of the end of the input sequence. If you wish to analyze other nucleases, you can input a fake guide sequence and position your expected cut site 3bp from the end of your sequence. We will add explicit support of other nucleases in upcoming versions of ICE.

    Note: You can copy and paste multiple file names by selecting multiple files in MacOS Finder or Windows Explorer and pasting into an Excel column.

    Overview of Editing Analysis by ICE

    Once the analysis is complete, a new screen appears with a graphical representation of the results and a list of the analyzed samples (see below).

    1. If the sample run has no issues, the analysis window will show a green checked circle in front of the sample name. Samples that were processed with a minor error will return a yellow checked circle. Typically, a yellow check mark indicates that ICE needed to adjust a particular parameter in order to generate results. If there are no results or there was a processing error, you will see a red exclamation point in front of that sample.You can hover over the yellow or red checked circles to gather details on the issuesassociated with each sample.

    2.Successfully analyzed samples will display the following parameters:

    Sample Label - The unique label name that you provided for each sample.

    ICE Score - The editing efficiency (percentage of the pool with non-wild type sequence) as determined by comparing the edited trace to the control trace. In the ICE algorithm, potential editing outcomes are proposed and fitted to the observed data using linear regression.

    R2 Score - When the ICE linear regression is computed during generation of the ICE Score, the Pearson correlation coefficient (r) is also computed and reported. The higher the R2 value, the more confident you can be in the ICE score.

    KO Score - Represents the proportion of cells that have either a frameshift or 21+ bp indel. This score is a useful measure for those who are interested in understanding how many of the contributing indels are likely to result in a functional Knockout (KO) of the targeted gene.

    Guide Sequence - This is the user-defined 17-23 nucleotide sequence of the DNA-targeting region of the guide RNA, excluding the PAM sequence.

    PAM Sequence - The Protospacer Adjacent Motif (PAM) sequence for the nuclease used. Currently, ICE is configured for the Cas9 nuclease from Streptococcus pyogenes (SpCas9). . The analysis can be sorted by any of the parameters displayed on the summary table. In order to search for a particular sequence or name, your browsers Control F functionality can be used to find a guide or name. Note: The control sequence is not listed in the summary table.

    4. The entire analysis can be downloaded as a .zip file by clicking Download Analysis Data on the bottom right of the analysis screen.

    5. Each sample can be individually inspected in greater detail by clicking on the sample name or on its corresponding bar graph entry. This will open up a new window with three tabs. To return to the main analysis screen, hit the back button at any time on the top left of the screen.

    Contributions

    The Contributions tab shows the inferred sequences present in your edited population and their relative representation in the edited pool. The black vertical dotted line represents the cut site, and + symbol on the far left marks the wild type. If you are viewing a multiplex sample, the cut site will be aligned to the most upstream cut site.

    Indel Distributions

    In the Indel Distributions tab, youll find an Indel plot which displays the inferred distribution of indel sizes in the entire edited population of genomes. Hovering over each bar of the Indel plot shows the size of the insertion or deletion (+ or - 1 or more nucleotides), along with the percentage of genomes that contain it.

    The discordance plot shows the level of disagreement between the non-edited wild type (control) and the edited sample in the inference window (the region around the cut site). It shows, base-by-base, the average amount of signal that disagrees with the reference sequence derived from the control trace file. On the plot, the green (edited sample) and orange (control sample) lines should be close together before the cut site, and a typical CRISPR edit results in a jump in the discordance near the cut site and continuing after the cut site (representing a high level of sequence discordance).

    Traces

    The Traces tab shows the edited and control, non-edited Sanger traces in the region around the guide binding site(s). The sequence base calls from the .ab1 file are also shown above each trace. The horizontal black underlined region represents the guide sequence, and the horizontal red underline is the PAM site. The vertical black dotted line represents the cut site. Cutting and error-prone repair typically result in mixed sequencing bases downstream of the cut.

    6. In order to return to the main analysis page containing all the samples, please click Back to all. You can also select any sample directly in the dropdown menu at the top of the screen after Analysis of _____. The Next and Previous buttons or pressing the arrow keys on your keyboard will also take you to the next sample on your summary table.

    For questions, please consult the FAQ, or contact us at [email protected]

    View Article
  • The Synthego CRISPR Design Tool sorts the guides by using several heuristics, such as cut site on the gene, common exon, and high activity. The CRISPR Design Tool preferentially chooses sequences that occur in earlier exons as an indel in these regions will improve the chances of knocking out the genes function. It then preferentially selects guide sequences in exons that are common to various splice variants. Finally, the CRISPR Design Tool uses on-target score (Doench et. al, 2016) and off-targets as a pass/fail criteria to select guide RNA sequences that we recommend for use to knockout a gene.

    View Article
  • Synthego RNA oligos are dried down prior to shipping and are shipped at room temperature. They are stable in this format for several weeks at room temperature, but it is best practice to store any undissolved RNA oligos at -20 C.

    For more information about dissolving, diluting, and storing your RNA please visit the Synthego Quick Start Guide found on the protocols page.

    View Article
  • Synthego Cas9 protein is shipped on cold packs at -20C. Synthego Cas9-2NLS has a concentration of 20M (20pmol/l) and is shipped in the following storage buffer formulation: 10mM Tris-HCl, 300mM NaCl, 1 mM DTT, 0.1mM EDTA, 50% Glycerol (pH 7.4 @ 25C)

    For more information about complexing the Cas9 with your gRNA and storing the complex please visit the Synthego Quick Start Guide found on the protocols page.

    View Article
  • Please consult the Synthego Quick Start Guide on the Resources page for RNP formation suggestions. In general, Synthego recommends Cas9:gRNA ratios between 1:3 and 1:9 for RNP formation.

    View Article
  • What does it mean when ICE reports that the "quality score is too low"?The ICE tool requires that the input sequence files are of a high enough quality that they can be properly interpreted and analyzed. If the tool reports that the quality score is too low, it means that either the experiment file or control file does not meet the tool's criteria for trace quality.

    What is causing the error?There are two reasons why the tool may recognize this quality error:1) The guide RNA target sequence(s) occur too close to either end of the amplicon.2) The trace peaks in the Sanger sequence file are too noisy for the sequencing provider to make reliable base calls.

    What can I do to fix these issues?1) Check that your guide is not in the first or last 50 bp of the sequencing trace or < 100bp from the end of the sequencing primer. In general, a 400-800 bp PCR amplicon length is best amenable to ICE analysis. It is best to design the forward and reverse primers at least 150 bp from the closest sgRNA cut-site to allow for optimal sequencing across the edit. 2) Check that your sequencing trace for the edited sample is not too noisy before the guide sequence - the noise will typically look like significant secondary trace peaks. If the trace is noisy, we would recommend using an internal nested primer to do your sequencing to get less noise in the trace. If the noise problem persists, you may want to investigate using another Sanger sequencing provider.3) Be sure to check that your .ab1 file contains the quality score field. If it does not contain this field, contact your sequencing provider to request this information.

    If the problem persists, please contact [email protected] with the following information:- Url link to the analysis results if available- Control and edited sample files with a description of which control file correspond to which edited file- Guide sequence(s) and which control/edited file pair it corresponds to- Screenshots of any error messages or relevant details.

    View Article
  • Custom RNA * - This product is ideal if you are working with Cpf1, C2c2,S.aureus Cas9 or any novel nuclease. The Custom RNA product line allows the user to define the entirety of the RNA sequence. This product group is further sub-divided into three categories based on the length of sequence you would like, ranging from 10-100nt in length. If you are looking for customizations beyond this, please contact us. Custom RNA - This product is ideal if you are working with Cpf1, C2c2,S.aureus Cas9 or any novel nuclease. The Custom RNA product line allows the user to define the entirety of the RNA sequence.

    sgRNA *- This is a full length 100-mer single guide RNA (sgRNA). When you order this product, you will simply specify the 20nt target sequence and we will synthesize it with an 80nt S.pyogenes Cas9-based scaffold to yield a full length 100-mer sgRNA.

    crRNA:tracrRNA * - This is a two-piece product. The crRNA is composed of a 20nt target sequence, which is specified by the user, and a 22-mer Synthego Linker sequence. The tracrRNA is an optimized 72-mer sequence based on S. pyogenes.

    *All of these products can be synthesized with chemical modifications which are critical for superior editing in certain applications. Click here to learn more about chemical modifications offered by Synthego.

    View Article
  • What does it mean when ICE reports "no alignment found between sample files"?In order for the ICE tool to accurately interpret and analyze the edited trace file relative to the control file, it must be able to align the two traces by base call. This allows the tool to compare the two traces base-by-base to determine differences and potential indel patterns.

    What is causing the error?It is possible that the ICE tool is unable to find alignment between the edited and control files if the traces are from different genomic loci.

    What can I do to fix these issues?Verify that the same PCR primers and sequencing primers were used for both the control and edited samples. You may also use a BLAST search to determine if both sequences map to the same genomic location.

    If the problem persists, please contact [email protected] with the following information:- Url link to the analysis results if available- Control and edited sample files with a description of which control file correspond to which edited file- Guide sequence(s) and which control/edited file pair it corresponds to- screenshots of any error messages or relevant details.

    View Article
  • Yes, Synthego's CRISPRevolution products can be used for gene Knockin experiments. To Knockin a sequence into the genome, the double-stranded break induced by Cas9 nuclease should be followed by homology-directed repair (HDR). The cell needs a homologous DNA template with the desired final genomic sequence, along with the target sgRNA and Cas9, for the HDR process to be effective. Only a relatively small percentage of the cells actively use this DNA template to repair the double strand break via homologous recombination, thereby incorporating the desired sequences into the genome.

    The Synthego CRISPRevolution RNA kit along with Cas9 protein are compatible with genome Knockin projects, along with your own design and development of a DNA template for the Knockin project.

    View Article
  • Transfection may need to be optimized for the cell type you are working with, and the type of delivery system you are using (e.g., electroporation, micro-injection etc.). In addition, optimization may be required depending on if you are expressing Cas9 within your cells or duplexing Cas9 nuclease with your guide RNA (annealed crRNA+tracrRNA) in vitro. If using Cas9 nuclease, it is important to consider nuclear localization signals (NLS) if working with eukaryotic cell types.

    Please visit synthego.com/resources for CRISPR protocols.

    View Article
  • Synthego will make a clonal cell line containing a protein coding gene knockout in any human immortalized cell line for you in as few as 10 weeks. We'll edit your gene of interest, derive clones from a highly edited pool of cells and deliver the edited cell clones - with 100% of cell containing the relevant gene knockout.

    We design top scoring guides to knock out your gene of interest in your cell line. These guides are synthesized as chemically modified sgRNA and delivered into the cells as ribonucleoprotein complexes with SpCas9 protein. The resulting cell pools are analyzed for total editing efficiency through Sanger sequencing and Inference of CRISPR Edits (ICE) analysis. We then clonally isolate and expand the edited cells and screen clonal cells to identify 100% homogenous and edited populations.

    View Article
  • Using the sequence of the guide RNAs, the CRISPR Design Tool identifies all the potential off-target sites across the same genome and determines the number of mismatches between each target guide RNA and all its potential off-target sites. Based on this information, the algorithm is able to score and rank the guides that have the least number of off-target sites.

    The off-target sites are presented as a string of values separated by commas in the All Guides tab of the CRISPR Design Tool. Here is an example of how to interpret the string:

    Off Targets: 0,0,1,0,35

    This sequence has 0 identical matches, 0 sequences with single-mismatch, 1 sequence with two-mismatches, 0 sequences with three-mismatches, and 35 sequences with four-mismatches.

    View Article
  • Synthego will knockout a protein-coding gene in any of 700+human immortalized cell lines for you in just 4-10 weeks. These cells will contain a heterogeneous pool of edits (indels), with greater than 50% editing efficiency and a guarantee of 50% protein knockout.

    To make the cells, we design top scoring guides to knock out your gene of interest in your cell line. These guides are synthesized as chemically modified sgRNA and delivered into the cells as ribonucleoprotein complexes with SpCas9 protein. The resulting cell pools are analyzed for total editing efficiency through Sanger sequencing and Inference of CRISPR Edits (ICE) analysis. We perform quality control checks prior to shipping you the cells.

    Learn more about Synthego Knockout Cell Pools in the Blog Post here:https://www.synthego.com/blog/crispr-knockout-cell-pools

    View Article
  • We can support this through the CRISPR Design Tool.

    Contact Us for more information.

    View Article
  • The ICE algorithm was developed internally by Synthego to analyze editing results using standard Sanger sequence reads. It is different from, but yields outputs that are similar to, the Tracking of Indels by Decomposition (TIDE) analysis, but with important extra features.

    The ICE modeling process reports an ICE score and a Pearson regression coefficient (r2). If the ICE r2 is high, the observed data is a very good fit with a combination of proposed edited sequences and you can be confident in the reported editing efficiencies. An ICE score of 100 with a high r2 value, for example, indicates that there is no wild-type sequence in the cell population being interrogated. If the r2 of an ICE score is low, the observed data fits poorly to any combination of proposed edited sequences.

    View Article
  • Yes, apart from the indels created by non-homologous end joining due to the double-stranded break created by the Cas9 protein at the desired cut site (mediated by the guide RNA), no other components are required nor are inserted into the genome of the cell.

    View Article
  • The CRISPR Design Tool has 100,000+ genomes representing more than 9,000 species. To identify whether your specific genome is available, you can search by genus and species on the CRISPR Design Tool page.

    The 100,000+ genomes has been curated from the following websites.

    http://www.ensembl.org/index.html

    https://www.ncbi.nlm.nih.gov/assembly

    https://www.gencodegenes.org

    View Article
  • For a chemically modified version of our CRISPRevolution products, we offer 2-O-methyl analogs and 3 phosphorothioate internucleotide linkages at the first three 5 and 3 terminal RNA residues in the following configuration:

    sgRNA: 5-U*A*A*UUUCACAGCUGCACAUA+Synthego ScaffoldU*U*U*-3

    OR

    crRNA: 5-U*A*A*UUUCACAGCUGCACAUA+Synthego LinkerU*G*G*-3

    +

    tracrRNA: 5-A*A*A*+Synthego ScaffoldU*U*U*-3

    *=modification

    Chemicalmodificationsprovide greater stability and protection from exonucleases to guide RNAs, allowing them to persist within cells for longer than unmodified guide RNAs. This persistence likely allows Ribonucleoprotein (RNP) complexes containing guide RNAs to access regions of the genome that may be challenging for Cas9 to interrogate due to cell cycle or heterochromatin bunching factors. In many primary cells, stem cells and cell lines of hematopoietic origin,chemicallymodifiedsgRNAs also protect against innate intracellular immune responses that can actively degrade RNA or trigger immune cascades that lead to cell death.

    Note that:The standard chemical modifications provided by Synthego arenot suitedfor use with Cpf1-based gRNA.Please contact us if you are interested in specialty modifications that are currently being evaluated for use with Cpf1.

    If youre interested in a chemically modified option, select Modifications from the dropdown menu when inputting your target sequence on the order page. If you would like alternative configurations or modifiers, please contact us.

    Click here for more information about chemically modified synthetic gRNA.

    View Article
  • In most cases, ICE will have an explanation of why the sample failed. For example, ICE may call a failure due to low sequencing quality. In this case we would recommend either cleaning up the PCR reaction before sequencing, or re-trying the PCR with different primers.

    View Article
  • Synthego uses proprietary synthesis technology to chemically synthesize high quality RNA oligonucleotides in either the single guide RNA (sgRNA) or two-part cr:tracrRNA formats for S.pyogenes Cas9 CRISPR editing. This technology can also be used to chemically synthesize guide RNAs for other nucleases such as Cpf1/Cas12a, SaCas9, and others or any RNA fragment up to 110nt. With a fully synthetic process, the RNA molecules are generated in a highly reproducible manner and can be synthesized to include chemical modifications.

    View Article
  • Synthego offers high quality 2NLSCas9 nuclease. You can get it right here.

    View Article
  • You can expect similar analysis results for standard CRISPR editing that involves the formation of Indels that result from a single CRISPR-Cas9 double-stranded DNA break.

    View Article
  • We guarantee high editing efficiencies of 50% or greater for the cell pool with at least 50% protein knockout. We regularly achieve an 80% median editing rate with editing efficiencies of up to 97%, even in difficult cell types. These high editing efficiencies will save you time by reducing the number of clones you have to screen by up to 5 times, enabling you to identify a knockout clone quicker. Leave the designing, optimizing and testing to us, so you can get on with your experiment.

    View Article
  • No, unfortunately at the moment we are only offering the pooled service for knockouts of coding genes. Please see our clonal cell engineering service for the capability of cell engineering of non-coding regions.

    View Article
  • Where possible, we will procure the cells ourselves. If they are not available from a commercial source, we will request you send them to us. Please contact us as soon as possible to start the process of putting in place a Material Transfer Agreement (MTA) to facilitate this.

    View Article
  • As of this release (1.0), ICE assumes you are using S.pyogenes Cas9. However, it does not check if the PAM site is NGG and just uses the input guide sequence to place the predicted cutsite 3bp upstream of the end of the input sequence. If you wish to analyze other nucleases, you can input a fake guide sequence and position your expected cut site 3bp from the end of your sequence. This guide sequence will be used by the tool and the algorithm does not enforce any particular PAM site. We will add explicit support of other nucleases in upcoming versions of ICE.

    View Article
  • The current version of ICE software can analyze indels that result from single or multiplex (up to three sgRNA delivered to cells at once) CRISPR-Cas9 double-strand DNA breaks using SpCas9. More features will be added to the ICE software tool soon. To request other nucleases or other features and functionalities, please email [email protected].

    The ICE tool also reports a "Knockout score" (KO-score) which represents the proportion of cells that have either a frameshift or 21+ bp indel. This score is a useful measure for those who are interested in understanding how many of the contributing indels are likely to result in a functional KO of the targeted gene.

    Future versions of the ICE tool will be able to analyze more complex CRISPR editing, such as knock-ins and single nucleotide variant (SNV) generation. (These are already available in the source code but not yet available for the web frontend).

    View Article
  • The sgRNA will target whichever strand it is complementary to and will bring Cas9 to induce a double-stranded break. To the best of our knowledge, the effectiveness of the sgRNA is not determined by which strand it is complementary to.

    View Article
  • Some of the benefits of using the ICE CRISPR editing analysis tool over TIDE include:

    Ability to run in batch mode, enabling the upload of multiple sequence files for analysis at once

    Calculation of more complex CRISPR editing outcomes (such as multiplex edits)

    No parameter changes are required to run analysis there is no need to adjust alignment or decomposition windows these are auto adjusted by ICE, resulting in more reproducible analysis results between users of the same sequences

    More detailed analysis results

    A stable web interface that is user-friendly and very fast to use

    Shareable links to results

    ICE is open source and is free to use for both academia and industry

    View Article
  • Once an order is created and you receive an email confirmation with a quote, you can click Pay for Order in the email to finalize your order. You will be sent an email notification that your order is in progress. In the provided link you will be able to view the details of your order along with information about when to expect shipment. Additionally, once the order ships, you will find a FedEx tracking number on the order page which you can use to track your shipment.

    View Article
  • You can find an invitation to try the "beta" version of our ICE knock-in analysis tool here.

    Since ICE KI Analysis is designed to work with Sanger data, it is most useful for analyzing knock-ins that fall within the practical range of Sanger sequencing. Synthego recommends an upper limit of 200nt insertions, including the homology arms aligned with this insert.

    This makes ICE perfect for looking at gene tagging knock-ins, which typically fall within this range. The tool can also be used to analyze SNV edits. It should be noted, however, that due to the limits of Sanger sequencing, results for these very small knock-ins will have a larger margin of error, sometimes overestimating the prevalence of SNV edits, and underestimating Wild Type in the sample population. Stringent adherence to proper PCR protocols can help ensure the maximum possible accuracy when generating Sanger data for use with ICE.

    Try running a few of your own knock-in samples through the tool, or take a look at our own example data. And please,don'tforget to leave your comments on our online Feedback Form.

    If you have any questions, please contact [email protected]. We will be happy to contact you via email for a follow-up conversation.

    View Article
  • We use our Design Tool, which we have optimized for creation of gene knockouts. The tool also takes into account location of the guide early in the exon, a guide sequence that is common across variants of that transcript and high on-target and low off-target scores.

    View Article
  • We do not currently offer the GKO Kit for all human genes. Some genes are excluded from the offer because we cannot guarantee knockoutwith them. This is because the guides available in that gene do not satisfy all of our stringent criteria (early exon, common exon, high on-target score, low predictedoff-targetscore).

    You can still go through design tool and order sgRNA "a la carte" then add-on Cas9 and a controls kit to essentially create your own GKO kit. As a little tip: since the guides found in the gene don't look to be optimal forknockout, you may consider multiplexing the guides (delivering 2 or 3 at a time to induce a small deletion). This will increase the likelihood of a knockout.

    View Article
  • The current version of the CRISPR Design Tool identifies guide RNAs that can knockout a gene by targeting the protein coding sequence. If you do not see recommended guide RNAs in introns, UTRs, promoters, or enhancers, it is because these regions have not been shown to be optimal for generating a gene knockout.

    We are still investigating UTRs, area-based targeting and other scoring methods to improve the quality of the recommendations to create a gene knockout.

    View Article
  • This feature is being developed and is coming soon.

    View Article
  • The Synthego CRISPR Design tool reports guide RNA sequences that are predicted to be the most effective for knocking out the target genes function. The CRISPR Design Tool uses very stringent criteria for selecting and recommending these guides. If the CRISPR Design Tool reports We found no recommended guides, then all the potential guides that were evaluated were unable to meet any one or more of the stringent criteria set by Synthego. You can still view all the guides that were found to target the gene, however, these may not necessarily be most effective for generating a gene knockout.

    In the "All Guides" page, you can search through different transcript and exons by using the drop-down menu. Because no recommended guides were found, we cannot necessarily come up with a design that will have a guaranteed or certain activity level associated with it. To select a suitable guide from those that are available, we would recommend that you preferentially select those that are:

    - Located within the exon

    - Have an activity level above 0.4

    - Have a low occurrence of predicted off-target sites. (0,0,0,X,X,X is preferable to 0,0,X,X,X,X)

    View Article
  • In brief, we deliver RNPs containing SpCas9 and the modified sgRNA into the cells using Nucleofection. Post cell recovery, we extract the genomic DNA, PCR amplify the edited site, sequence the site using Sanger sequencing and analyze the data using ICE software.

    Check out the detailed Nucleofection protocol in the CRISPR Transfection Protocols Pack

    View Article
  • We dont! We do not want to add anything into your genome thatisn'tnecessary and due to our high editing efficiency, we do not need to apply selection pressure to our cells. We achieve median editing rates of 80% using our modified sgRNA guides and highly optimized process, thus enabling you to either use the cells as a pool within a short timeframe or to use the pool of cells to create a clonal cell line.

    View Article
  • You can change your order (change or edit the items in your cart) if the order has not been submitted or paid for. Simply go to the bottom of the summary page (or follow the link in the email you received when the order was started). There is a link to go back and edit your order. This will allow you to make changes, such as change addresses, quantity of products, types of products etc. Once the changes are made, proceed to the order summary page and pay for the order.

    Note: The old quote/order is automatically cancelled and a new order number will be created/assigned.

    If you have already completed and paid for your order and need to change the address, please email [email protected] and provide your order number and the correct information. Please ensure that valid addresses are entered at the time of ordering. Incorrect or invalid addresses will delay order approval or shipment.

    View Article
  • We have found that ICE performs well against NGS, and in general we see very good agreement in Indel distribution between these two methods. Check out this publication ( Hsiau, et al. biorxiv (2018).regarding a comparison between ICE and existing CRISPR analysis methods in the near future.

    View Article
  • Using Synthego synthetic RNA as your guide RNA for CRISPR offers many advantages over traditional guide RNA synthesis techniques:

    Speed

    Synthetic RNA can save you up to a week on your CRISPR experiments. Compared to plasmid-based RNA guides, there is no need to design, construct, sequence verify and purify plasmid DNA for every target/guide you want to test. And theres no need to spend precious lab hours working with expensive IVT kits. Use your extra time to catch up on other experiments!

    Accuracy

    Have greater control and precision for your CRISPR genome editing by controlling the exact amount of RNA for your transfection or microinjection.

    Quality

    When forming ribonucleoprotein (RNP) complexes with Cas9, you will get the cleanest possible edits. After transfection and genome editing have occurred, Cas9 and exogenous RNA will degrade. The probability of off-target effects are greatly reduced without continuous expression of Cas9 and/or guide RNA.

    Price

    Synthetic RNA offers an unbeatable price point when compared to the cost (and labor) of preparing guide RNA through plasmid or IVT methods. Synthego can synthesize cr/tracrRNA and sgRNA at smaller scales than anyone else in the industry meaning you only pay for what you need.

    High Throughput Ready

    Synthetic RNA offers the kind of scalability not feasible with other traditional guide RNA generation techniques. Whether you want to test one target per gene or a hundred, its as easy as ordering the RNA through our online portal. Synthetic RNA allows you to order libraries of thousands of guide RNAs to test avoid huge amounts labor and cost involved in creating guides using plasmids or IVT for high throughput applications!

    Easy to use

    Once a target sequence has been selected its easy to order RNA oligos through our online portal which makes it as simple to order RNA for a single target as it does for a hundred. Once you click order, just sit back, relax and wait for your lyophilized RNA to show up in a few days.

    ------------------------------------------------------------------------------------------------------------------------

    For more information about why Synthetic sgRNA is superior to IVT- or plasmid-derived gRNA, please visit our Resource Center and look for the 3 Reasons to Stop Using IVT for CRISPR eBook

    View Article
×
Rate your company